Journal: Pathology and Oncology Research

Article Title: Pathological Changes and Expression of JAK-STAT Signaling Pathway Hallmark Proteins in Rat Retinas at Different Time Points After Retinal Ischemia Reperfusion Injury

doi: 10.3389/pore.2022.1610385

Figure Lengend Snippet: Immunohistochemistry staining showing protein expression and localization of JAK2, STAT3, p-JAK2, p-STAT3, Bcl-2, and Bax in control, RIRI 0, 6, 24, 72, and 144 h groups. (A) Protein expression of JAK2, STAT3, p-JAK2, p-STAT3, Bcl-2, and Bax in six groups. Scale bar = 50 μm. (B–G) Analysis of JAK2 (B) , STAT3 (C) , p-JAK2 (D) , p-STAT3 (E) , Bcl-2 (F) , and Bax (G) in six groups. N = 5 sections for measuring per group. Compared with control group; ns, no significance, * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Primary antibodies were as follows: JAK2 (bs-23003r, Bioss), STAT3 (60199-1-lg, Proteintech), p-JAK2 (ab32101, Abcam), p-STAT3 (sc-8059, Santa), Bcl-2 (ab194583, Abcam), and Bax (A19684, ABclonal).

Techniques: Immunohistochemistry, Staining, Expressing

Journal: Pathology and Oncology Research

Article Title: Pathological Changes and Expression of JAK-STAT Signaling Pathway Hallmark Proteins in Rat Retinas at Different Time Points After Retinal Ischemia Reperfusion Injury

doi: 10.3389/pore.2022.1610385

Figure Lengend Snippet: The hallmarker protein expression of JAK-STAT signaling pathway in control, RIRI 0, 6, 24, 72, and 144 h groups. (A) Protein expression of JAK2, p-JAK2, STAT3, and p-STAT3 in six time points groups. (B–E) Analysis of JAK2 (B) , p-JAK2 (C) , STAT3 (D) , and p-STAT3 (E) in six groups. N = 3–6 repeats per group. Compared with control group, ns, no significance, * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Primary antibodies were as follows: JAK2 (bs-23003r, Bioss), STAT3 (60199-1-lg, Proteintech), p-JAK2 (ab32101, Abcam), p-STAT3 (sc-8059, Santa), Bcl-2 (ab194583, Abcam), and Bax (A19684, ABclonal).

Techniques: Expressing

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Expressing, Control

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Migration, Flow Cytometry, Expressing, Control

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Inhibition

Journal: Iranian Journal of Basic Medical Sciences

Article Title: Lavender protects H9c2 cardiomyocytes against oxygen-glucose deprivation (OGD)-induced injury via targeting the JAK2/STAT3 pathway

doi: 10.22038/IJBMS.2022.54751.12280

Figure Lengend Snippet: Expression of Jak2/Stat3 in immunocytochemical staining was significantly decreased after treatment compared with the OGD-induced injury (ISC) group (*** P <0.001 vs control; ## P <0.01 vs ISC)

Article Snippet: JAK2 Polyclonal Antibody (bs-23004R) was supplied by Bioss Inc. Immobilon®-FL PVDF membrane pore size 0.45 μm was purchased from Sigma (St. Louis, MO, USA).

Techniques: Expressing, Staining